View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10066_low_9 (Length: 327)
Name: NF10066_low_9
Description: NF10066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10066_low_9 |
 |  |
|
| [»] scaffold0280 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0280 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 323
Target Start/End: Complemental strand, 11785 - 11479
Alignment:
| Q |
17 |
cttgcaacgtggacttcaaaagcagtgatcatatgaaaacttagtctgaaaacctaatttcttctttaacatggtatgaaattttagctctgcgctgttt |
116 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11785 |
cttgcaacattgacttcaaaagcagtgatcatatgaaaacttaatctgaaaaccaaatttcttctttaacatggtatgaaattttagctctgcgctgttt |
11686 |
T |
 |
| Q |
117 |
tcttaaccttctcatacgaaaacctaataatttaaccttcaaagccttcattctgttcctcccttgctcaacgctatcatctctaaccgaagtttcgggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11685 |
tcttaaccttctcatacgaaaacctaataacttaaccttcaaagccttcattctgttcctcccttgctcaacgctatcatctctaaccgaagtttcgggg |
11586 |
T |
 |
| Q |
217 |
ctgacatttactactcttttaccattttctttcatttcaaacatgttcttgcttctgttactatctaactcaacattatcagcttcagatgaagtttcat |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11585 |
ctgacatttactactcttttaccattttctttcatttcaaacatgttcttgcttctgttactatctaactcaacattatcagcttcaaatgaagtttcat |
11486 |
T |
 |
| Q |
317 |
ctcactc |
323 |
Q |
| |
|
|| |||| |
|
|
| T |
11485 |
ctaactc |
11479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University