View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10067_high_6 (Length: 240)
Name: NF10067_high_6
Description: NF10067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10067_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 151
Target Start/End: Original strand, 6068378 - 6068522
Alignment:
| Q |
7 |
agtagcaaaggagatagtatgacttggtagtcaaatttgttttacaagaatgacttgcggattgttactggagtatgaagccacattagtaaaggagatg |
106 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068378 |
agtagtaaaggagatagtatgacttgctagtcaaatttgttttacaagaatgacttgcggattgttactggagtatgaagccacattagtaaaggagatg |
6068477 |
T |
|
| Q |
107 |
catgaattgaatggcaaccttctgcaaaaatactagtgcatccag |
151 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6068478 |
catgaattgaatggcaaccttcttcaaaaatactagtgcatccag |
6068522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University