View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10067_low_10 (Length: 245)
Name: NF10067_low_10
Description: NF10067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10067_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 4269821 - 4269730
Alignment:
| Q |
22 |
tcgattgcttggaggtaatgtccaacacctctttcgactactcttattgctgattcaatggagacaacttttctatgagtttaagatgtgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269821 |
tcgattgcttggaggtaatgtccaactcctctttcgactactcttattgctgactcaatggagacaacttttctatgagtttaagatgtgtt |
4269730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 22081503 - 22081417
Alignment:
| Q |
19 |
gactcgattgcttggaggtaatgtccaacacctctttcgactactcttattgctgattcaatggagacaacttttctatgagtttaa |
105 |
Q |
| |
|
||||| || ||||||||| ||||| ||| |||||||||||||||||| |||||| || |||||||||||||| || ||||||||| |
|
|
| T |
22081503 |
gactcaatcgcttggaggcaatgttaaacttctctttcgactactcttagtgctgactccatggagacaactttcctctgagtttaa |
22081417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 92
Target Start/End: Original strand, 1583232 - 1583286
Alignment:
| Q |
38 |
aatgtccaacacctctttcgactactcttattgctgattcaatggagacaacttt |
92 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||||||||| || |||| ||||||||| |
|
|
| T |
1583232 |
aatgtctaactcctctttcggctactcttattgctgactccatggggacaacttt |
1583286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 19224522 - 19224575
Alignment:
| Q |
19 |
gactcgattgcttggaggtaatgtccaacacctctttcgactactcttattgct |
72 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
19224522 |
gactcgatcgcttggagacaatgtccaactcctctttcgactactcttattgct |
19224575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University