View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10067_low_9 (Length: 250)
Name: NF10067_low_9
Description: NF10067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10067_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 231
Target Start/End: Original strand, 10765255 - 10765473
Alignment:
| Q |
12 |
tgtttaagcgacttaatgtttttggtggagagatgtgttgatatcttgttagtcttggactatcagttcgttattgctctcgacgtttctgatactccgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||| |
|
|
| T |
10765255 |
tgtttaagcgacttaatgtttttggtggagagatgtgttgatatcttgttagtcttggactatcggtttgttattgctctcgacgtt-ctgatactccgg |
10765353 |
T |
|
| Q |
112 |
aacatagaggacctaattataattgtgatatttggagaatcaaatggccagatgaaaacagttaggccatagttgtgatacttgaagaactcaactaatg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10765354 |
aacatagaggacctaattataattgtgatatttggagaatcaaatggccagatgaaaacagttaggccatagttgtgatacttgaagaactcaactaatg |
10765453 |
T |
|
| Q |
212 |
caattgataacggagggacc |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10765454 |
caattgataacggagggacc |
10765473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University