View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10068_high_9 (Length: 250)
Name: NF10068_high_9
Description: NF10068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10068_high_9 |
 |  |
|
[»] scaffold0280 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0280 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 9437 - 9679
Alignment:
Q |
1 |
tgatgactattttacagctgtgatttgagttatgtcgtttaatttgttatttgttgtgagtgtttggaataggttcgattatgttgctttttcgcggaga |
100 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
9437 |
tgatgactattttactaatgtgatttgagttatgtcgtttaatttgttatttgttgtgagtgtttggaataggttcgattatgttgcttttccgcggaga |
9536 |
T |
 |
Q |
101 |
ttttggttgtgtgctttatactggtgattttcgttgggaagctggttgtgagaaggcaaggattgcaaaaaatatgcttggtgttgctcttgaggaacat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
T |
9537 |
ttttggttgtgtgctttatactggtgattttcgttgggaagctggttgtgagaaggcaaggattgccaaaaatatgcttggtgttgctcttaaggaacat |
9636 |
T |
 |
Q |
201 |
gatggtgatgttgatgttgtttatcttgataatacctatgcta |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
9637 |
gatggtgatgttgatgttgtttatcttgataatacttatgcta |
9679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 5 - 243
Target Start/End: Original strand, 21910254 - 21910490
Alignment:
Q |
5 |
gactattttacagctgtgatttgagttatgtcgtttaatttgttatttgttgtgagtgtttggaataggttcgattatgttgctttttcgcggagatttt |
104 |
Q |
|
|
||||||||||| || |||||| |||| |||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
21910254 |
gactattttactactttgatttcagttctgtcgtttgatttgttatttgttg--agtttttggaataggttcgattatgttgctttttcgtggagatttt |
21910351 |
T |
 |
Q |
105 |
ggttgtgtgctttatactggtgattttcgttgggaagctggttgtgagaaggcaaggattgcaaaaaatatgcttggtgttgctcttgaggaacatgatg |
204 |
Q |
|
|
||||||| |||| |||| ||||||||||||||||||| | |||||||||||||||||||||| | | | ||||||||||||||||| |||||||||||| |
|
|
T |
21910352 |
ggttgtgagcttcataccggtgattttcgttgggaaggtagttgtgagaaggcaaggattgctagagaaatgcttggtgttgctctaaaggaacatgatg |
21910451 |
T |
 |
Q |
205 |
gtgatgttgatgttgtttatcttgataatacctatgcta |
243 |
Q |
|
|
||| |||||||||||||| ||||||||||| ||||||| |
|
|
T |
21910452 |
gtgttgttgatgttgtttgccttgataatacttatgcta |
21910490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University