View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10068_low_6 (Length: 289)
Name: NF10068_low_6
Description: NF10068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10068_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 26877677 - 26877515
Alignment:
Q |
1 |
ttatttatatgttatatgaaagtctatgcccaacaattttaaaaaataactagaattagannnnnnnnnnnnnnnnngaataagctaaattagtaccact |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
26877677 |
ttatttatatgttatatgaaagtctatgcccagcaattttcaaaaataactagaattagtttttttttttt-------aataagctaaattagtaccact |
26877585 |
T |
 |
Q |
101 |
cttagaccacaagaagtcatgaaattgtgtcacctaaaacatcaaaatttacataggaacttgttaattc |
170 |
Q |
|
|
|||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
26877584 |
cttagaccacaacaagtcatgaaagtgtgtcacctaaagcatcaaaatttacataggaacttgttaattc |
26877515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 272
Target Start/End: Complemental strand, 26877462 - 26877417
Alignment:
Q |
229 |
tactagtagtataaaacaagtgtat--gaaactctaagatgatttg |
272 |
Q |
|
|
||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
26877462 |
tactagtagtataaaacaagtatatatgaaactctaagatgatttg |
26877417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University