View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10068_low_7 (Length: 276)
Name: NF10068_low_7
Description: NF10068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10068_low_7 |
 | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0280 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 9136 - 9299
Alignment:
| Q |
19 |
tacttcccatcaaatttcccaatttcaatctctcccttcttcgcattcttcatactggcacttctcacactctctcactccgttcgccttcttcttccga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9136 |
tacttcccatcaaatttcccaatttcaatctctcccttcttcgcattcttcatactggcacttctcacactctctcactccgttcgccttcttcttccga |
9235 |
T |
|
| Q |
119 |
tcccaccaccgtcattgtcaccgccatcgacgcctgtcactgtcccggtacgtaaccctaaccc |
182 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9236 |
tcccaccaccgttgttgtcaccgctatcgacgcctgtcactgtcccggtacgtatccctaaccc |
9299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 21909536 - 21909686
Alignment:
| Q |
19 |
tacttcccatcaaatttcccaatttcaatctctcccttcttcgcattcttcatactggcacttctcacactctctcactccgttcgccttcttcttccga |
118 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||| |||||||||||||||||||| || |||||| ||||||||||||| |||||||||||| | |
|
|
| T |
21909536 |
tacttccaatcaaattccccaatttcaatctctctcttctccgcattcttcatactggcacctcccacactatctcactccgttcaccttcttcttccaa |
21909635 |
T |
|
| Q |
119 |
tcccaccaccgtcattgtcaccgccatcgacgcctgtcactgtcccggtac |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21909636 |
tcccaccaccgtcattgtcaccgccatcgatgcctgtcactgtcccggtac |
21909686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University