View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10069_low_10 (Length: 254)
Name: NF10069_low_10
Description: NF10069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10069_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 71 - 254
Target Start/End: Original strand, 38043627 - 38043810
Alignment:
| Q |
71 |
caataaaacttgaaaaaacaggattccaaatagtactacatatgacagtttttggatgaactggcacactcatatagttggtccacttcattgagaaatc |
170 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38043627 |
caataaaactggaaaaaacaggattccaaatagtactacatatgacagtttttggatgaactggcacactcatatagttggtccacttcattgagaaatc |
38043726 |
T |
 |
| Q |
171 |
aaggcacaggaaagtgatgtatcatctcattattcatgcaagatattacaacgaagacatgtcctaaatcaggtcccctctcct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38043727 |
aaggcacaggaaagtgatgtatcatctcattattcatgcaagatattacaacgaagacatgtcctaaatcaggtcccctctcct |
38043810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University