View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10069_low_9 (Length: 256)
Name: NF10069_low_9
Description: NF10069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10069_low_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 256
Target Start/End: Complemental strand, 6567532 - 6567295
Alignment:
| Q |
20 |
aagggttaagactaaaaatatatacatgagtgtatgctactaatgtgtcataataaggctaataaacttgacttatcaatgtgtaatagccttttcttat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6567532 |
aagggttaagactaaaaatatatacatgagtgtatgctactaatgtgtcataataaggctaataaacttgacttatcaatgtgtaatagccttttcttat |
6567433 |
T |
 |
| Q |
120 |
atatcaaatgtagccttgtgtttttgccaaacgaaattttatactt-ttttccggatctttaagttacgaagactaatctcttaattttttagattatat |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6567432 |
atatcaaatgtagccttgtgtttttgctaaacgaaattttatactttttttccggatctttaagttacgaagactaatctcttaattttttagattatat |
6567333 |
T |
 |
| Q |
219 |
tttagcgggttaaggtacaaagactaatttttcaaaat |
256 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
6567332 |
tttagaggtttaaggtacaaagactaattttttaaaat |
6567295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University