View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10070_high_30 (Length: 345)

Name: NF10070_high_30
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10070_high_30
NF10070_high_30
[»] chr4 (1 HSPs)
chr4 (12-82)||(21207664-21207734)
[»] chr7 (1 HSPs)
chr7 (226-274)||(37927541-37927589)


Alignment Details
Target: chr4 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 12 - 82
Target Start/End: Complemental strand, 21207734 - 21207664
Alignment:
12 gaggagcagagataacatatttaacactctttataataagacaattgatagcgcgagaaagtgtcgtatgc 82  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21207734 gaggagcagaaataacatatttaacactctttataataagacaattgatagcgcgagaaagtgtcgtatgc 21207664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 37927589 - 37927541
Alignment:
226 gaagaatgacattaatggttgttaaagtttcaaacaattgttaaatatc 274  Q
    ||||| |||| || || |||||||||||||||||||||| |||||||||    
37927589 gaagagtgacgttgatcgttgttaaagtttcaaacaatttttaaatatc 37927541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University