View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_high_60 (Length: 213)
Name: NF10070_high_60
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 58 - 183
Target Start/End: Original strand, 38249057 - 38249182
Alignment:
| Q |
58 |
tggtgagtagattgcaaaacgacggcggaattggtggggaaagggggcgatgacgaccccttgtatagtggataatgaatcggatagataaagaatcaat |
157 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
38249057 |
tggtgagtagcatgcaaaacgacggcggaattggtggggaaagggggcgacgacgaccccttgtatagtggatattgaatcggatagatgaagaatcaat |
38249156 |
T |
 |
| Q |
158 |
agtatccttatgagtttagtttagtt |
183 |
Q |
| |
|
||||| || ||||||||||||||||| |
|
|
| T |
38249157 |
agtattctcatgagtttagtttagtt |
38249182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 129
Target Start/End: Original strand, 14227901 - 14227972
Alignment:
| Q |
58 |
tggtgagtagattgcaaaacgacggcggaattggtggggaaagggggcgatgacgaccccttgtatagtgga |
129 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||||||||||||||| | || ||||||||| ||||| |
|
|
| T |
14227901 |
tggtgagtagcatgcgaaacgacggtggaattggtggggaaagggggcgacggtgatcccttgtatggtgga |
14227972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Original strand, 37810852 - 37810907
Alignment:
| Q |
74 |
aaacgacggcggaattggtggggaaagggggcgatgacgaccccttgtatagtgga |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| | | ||||||||||| ||||| |
|
|
| T |
37810852 |
aaacgacggcgaaattggtggggaaaggggacgacggcaaccccttgtatggtgga |
37810907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University