View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_high_8 (Length: 599)
Name: NF10070_high_8
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_high_8 |
 |  |
|
| [»] scaffold0202 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 1e-36; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 141 - 235
Target Start/End: Original strand, 31093208 - 31093302
Alignment:
| Q |
141 |
ttaaaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttagga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31093208 |
ttaaaatgctttcccggaactggatgagatcaaaatcattgggatatggatatgcaatatcacattagtggactaaccctctagcttgtttagga |
31093302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 415 - 549
Target Start/End: Complemental strand, 31074093 - 31073966
Alignment:
| Q |
415 |
ttttgtgcctagtgaaaaaatgtatgatggagtcccataacaccacttagttcatacagttttgtcatgtaatgtactatgacctaaataatttaaccac |
514 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||| || ||||||| | |||||||||||| || ||||||||||||||| |
|
|
| T |
31074093 |
ttttgtgggtagtgaagtaatgtatgatggagtcccataacaccacttagttcattcaattttgtcttataatgtactatggccaaaataatttaaccac |
31073994 |
T |
 |
| Q |
515 |
cctcttcccccttcatcatactttaaattattcca |
549 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
31073993 |
cct-------cttcatcatactttaaattattcca |
31073966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 144 - 236
Target Start/End: Complemental strand, 31034026 - 31033934
Alignment:
| Q |
144 |
aaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag |
236 |
Q |
| |
|
||||||||||| | |||||||| || ||| ||||||| |||| |||||| ||||||| | | ||||||||||||| || ||| |||||||| |
|
|
| T |
31034026 |
aaatgctttcctgaaactggataaggtcataatcatcagggtttggatattcaatatcgaagtcgtggactaaccctttaccttttttaggag |
31033934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 61; Significance: 7e-26; HSPs: 1)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 52 - 236
Target Start/End: Original strand, 1856 - 2020
Alignment:
| Q |
52 |
cttgtctatggtgtatttggaaggctaggaatgcgagnnnnnnnntcacgatataagtgtttcgactgatactattttagaactgcattttaaaatgctt |
151 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
1856 |
cttgtctatagtgtatttggaaggctaggaatgcga--aaaaaattcacgatataagtgtttcgactgatactatttcagaacagg---ttaaaatgctt |
1950 |
T |
 |
| Q |
152 |
tcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag |
236 |
Q |
| |
|
||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951 |
tcctggaaccggatgagatct---------------ggatatgcaatatcacattagtggactaaccctctagcttgtttaggag |
2020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 147 - 236
Target Start/End: Original strand, 30980 - 31069
Alignment:
| Q |
147 |
tgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag |
236 |
Q |
| |
|
|||||||| | |||||||| || |||||||||||| ||| ||||||||||||||| | | |||||||||||||||| ||| |||||||| |
|
|
| T |
30980 |
tgctttcctgaaactggataaggtcaaaatcatcgaggtttggatatgcaatatcaaagttgtggactaaccctctaccttttttaggag |
31069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 30858 - 30927
Alignment:
| Q |
17 |
agatacaaaattgggtataagaatgatttgaattgcttgtctatggtgtatttggaaggctaggaatgcga |
87 |
Q |
| |
|
||||||| |||||| |||||||| |||||| |||||||||||||| |||| ||||||||| |||||||| |
|
|
| T |
30858 |
agatacataattgg-tataagaacaatttgacttgcttgtctatggattattgggaaggctaagaatgcga |
30927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University