View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_29 (Length: 403)
Name: NF10070_low_29
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Complemental strand, 32643905 - 32643526
Alignment:
| Q |
1 |
agtgtgtgaattcgtgatgtggtacctcgtgttgcaatcataattttgcttttcaaaactatctgcaaaacatcattaaaaattcgagtgcatgtgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643905 |
agtgtgtgaattcgtgatgtggtacctcgtgttgcaatcataattttgcttttcaaaactatctgcaaaacatcattaaaaattcgagtgcatgtgttat |
32643806 |
T |
|
| Q |
101 |
ttagaacattttttatgccggttattgccgtgtaccgtttcaagatgaacatctgaagagagatgtcctttttcacgagccttgtagtcaagggcaatcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32643805 |
ttagaacattttttatgccggttattgccgtgtgccttttcaagatgaacatctgaagagagatgtcctttttcacgagccttgtggtcaagggcaatcc |
32643706 |
T |
|
| Q |
201 |
acccccaattgggatggcaggttcatcctttcccaaaatttgcaagcatgttacagcttcattcacaagagcattgataacagtgccttgtagaactgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32643705 |
acccccaattgggatggcaggttcatcctttcccaaaatttgcaagcaagttacagcttcattcacaagagcattgataacagtgccttgtagaagtgtt |
32643606 |
T |
|
| Q |
301 |
acttttgagacaaggttatggtacccaactttttcaagccaaagccagagagccatgactagaagagattgagtcacctc |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643605 |
acttttgagacaaggttatggtacccaactttttcaagccaaagccagagagccatgactagaagagattgagtcacctc |
32643526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University