View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_30 (Length: 403)
Name: NF10070_low_30
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 23 - 388
Target Start/End: Complemental strand, 52584983 - 52584618
Alignment:
| Q |
23 |
tgctcaacctcaatagggcttcgtgcacctagtacggattcaccacttctatgttaatgtcttattaactcatgtcttcagaatatatactatactagct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584983 |
tgctcaacctcaatagggcttcgtgcacctagtacggattcaccacttctatgttaatgtcttattaactcatgtcttcagaatatatactatactagct |
52584884 |
T |
 |
| Q |
123 |
tttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctctttttccataaaaatctc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52584883 |
tttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctccttttccataaaaatctc |
52584784 |
T |
 |
| Q |
223 |
tcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttccaattgagttgttcccttaagggacacaatacaatacaagtat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584783 |
tcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttccaattgagttgttcccttaagggacacaatacaatacaagtat |
52584684 |
T |
 |
| Q |
323 |
agaactagtttattttttcaatcactttctctcagacnnnnnnngctagctacaattaatgatgtc |
388 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52584683 |
agaactagtttatttattcaatcactttctctcagacaaaaaaagctagctacaattaatgatgtc |
52584618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University