View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_39 (Length: 345)
Name: NF10070_low_39
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10070_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 12 - 82
Target Start/End: Complemental strand, 21207734 - 21207664
Alignment:
Q |
12 |
gaggagcagagataacatatttaacactctttataataagacaattgatagcgcgagaaagtgtcgtatgc |
82 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21207734 |
gaggagcagaaataacatatttaacactctttataataagacaattgatagcgcgagaaagtgtcgtatgc |
21207664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 37927589 - 37927541
Alignment:
Q |
226 |
gaagaatgacattaatggttgttaaagtttcaaacaattgttaaatatc |
274 |
Q |
|
|
||||| |||| || || |||||||||||||||||||||| ||||||||| |
|
|
T |
37927589 |
gaagagtgacgttgatcgttgttaaagtttcaaacaatttttaaatatc |
37927541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University