View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_48 (Length: 316)
Name: NF10070_low_48
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 37044819 - 37044532
Alignment:
| Q |
20 |
caaggtatagtatatttctctgatatgaaaatgttattgtgaatttgttacgctgtttacttattctgacaagtttaagaatggtattgcttggacttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37044819 |
caaggtatagtatatttctctgatatgaaaatgttattgtgaatttgttacgctgtttacttattctgacaagtttaagaatggtattgcttggacttgg |
37044720 |
T |
 |
| Q |
120 |
attgtagttggatatcatggacagaggtaccgatgctcggaatctgttactggggaaagttatccccctccgacttggttatgtcggtgttgtaaatcgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37044719 |
attgtagttggatatcatggacagaggtaccgatgctcggaatctgttactggggaaagttatccccctccgacttggttatgtcggtgttgtaaatcgt |
37044620 |
T |
 |
| Q |
220 |
agccaggaggtaacgtgttctttacttatatttcatcctgctgtaataaattgcagacagtttctgacttactacatttagcctttgc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37044619 |
agccaggaggtaacgtgttctttacttatatttcatcctgctgtaataaattgcagacagtttctgacttactacatttagcctttgc |
37044532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 122 - 232
Target Start/End: Original strand, 2026998 - 2027108
Alignment:
| Q |
122 |
tgtagttggatatcatggacagaggtaccgatgctcggaatctgttactggggaaagttatccccctccgacttggttatgtcggtgttgtaaatcgtag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || |||||||||| ||| |||||||| |||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
2026998 |
tgtagttggatatcatggacagaggtacagatgcccgtaatctgttacagggaaaagttattcccctccgacttggctatgttggtgttgtaaaccgtag |
2027097 |
T |
 |
| Q |
222 |
ccaggaggtaa |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
2027098 |
tcaggaggtaa |
2027108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University