View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_51 (Length: 286)
Name: NF10070_low_51
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 41 - 79
Target Start/End: Complemental strand, 43170062 - 43170023
Alignment:
| Q |
41 |
tcactgatttgctatttgattaaat-ttttacactctatt |
79 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43170062 |
tcactgatttgctatttgattaaattttttacactctatt |
43170023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University