View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_55 (Length: 264)
Name: NF10070_low_55
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 117 - 243
Target Start/End: Original strand, 29971849 - 29971974
Alignment:
| Q |
117 |
gtcacttttcctttctttgaatctttcttccaaaactaaaacgccatcatcatcaccacctcctaattactatgatatcttcaacactcacaaatcactt |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29971849 |
gtcacttttcctttctttgcatctttcttccaaaactaaaacaccatca-catcaccacctcctaattactatgaaatcttcaacactcacaaatcactt |
29971947 |
T |
 |
| Q |
217 |
ttgagttctactttctttccacgatct |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29971948 |
ttgagttctactttctttccacgatct |
29971974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 16 - 87
Target Start/End: Original strand, 29971760 - 29971831
Alignment:
| Q |
16 |
agagaataaagagaatacgtggtgggagcagcgcaaacatagcctgacagagatcaagacccaaacttagtt |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29971760 |
agagaataaagagaatacgtggtgggagcagcgcaaacatagtctgacagagatcaagacccaaacttagtt |
29971831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University