View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_56 (Length: 263)
Name: NF10070_low_56
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 7165222 - 7165459
Alignment:
| Q |
11 |
caaaaatcactcactaccttaaccgcgctaagctcatcgattcaattcggctttcactacgttccaataaccctaattccacactccccactctcataaa |
110 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7165222 |
caaaaatcactcactaccttaaccgtgctaagctcatcgattcaattcggctttcactacgttccaataaccctaattccacactctccactctcataaa |
7165321 |
T |
 |
| Q |
111 |
ccaccgtttattcgactcattcgtcctcactcacgctcttcgttctgccccttgtgcagattctgcactttcccttattcatatcattgagaacacaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7165322 |
ccaccgtttattcgactcattcgtcctcactcacgctcttcgttctgccccttgtgcagactctgcactttcccttattcataccattgagaacacaaaa |
7165421 |
T |
 |
| Q |
211 |
agttccaatttttcacatacccaaaatacccttcatgc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165422 |
agttccaatttttcacatacccaaaatacccttcatgc |
7165459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University