View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_59 (Length: 259)
Name: NF10070_low_59
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 75 - 242
Target Start/End: Original strand, 12000560 - 12000715
Alignment:
| Q |
75 |
tctgcaaagacagtggttgataatgaggtgtttcttcaattgtttcttttattacttcaattgccgcctcttttgagagtatagttagttagtatataag |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
12000560 |
tctgcaaagacagtggttgataatgaggtgtttcttcaattgtttcttttattacttcaattgccgcctc-tttgagagtatagttagttag--tataag |
12000656 |
T |
|
| Q |
175 |
tcatgtcgttgactcattttgtatcattttactcatttctatggataccatgacttttaacagcctct |
242 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12000657 |
tcatgccgttgacgcattttgta---------tcatttctatggataccatgacttttaacagcctct |
12000715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University