View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_60 (Length: 256)
Name: NF10070_low_60
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 72 - 246
Target Start/End: Complemental strand, 11326262 - 11326088
Alignment:
| Q |
72 |
cttctttacatgtaatacagtgatcaatccataacaagaatcattaataaattgatttacttgacattaggaatttaggaccaaattattggtttattct |
171 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11326262 |
cttctttacatgtaatacagtgaacaatccataacaagaatcattaataaattgatttacttgacattacgaatttaggaccaaattattggtttattct |
11326163 |
T |
 |
| Q |
172 |
tgaaacaaaacaatggatagaatgatttttatttacaagcaaatgcaaggataaactgatgtggggctctctctg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11326162 |
tgaaacaaaacaatggatagaatgatttttatttacaagcaaatgcatggataaactgatgtggggctctctctg |
11326088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 72 - 246
Target Start/End: Complemental strand, 11484283 - 11484109
Alignment:
| Q |
72 |
cttctttacatgtaatacagtgatcaatccataacaagaatcattaataaattgatttacttgacattaggaatttaggaccaaattattggtttattct |
171 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11484283 |
cttctttacatgtaatacagtgaacaatccataacaagaatcattaataaattgatttacttgacattacgaatttaggaccaaattattggtttattct |
11484184 |
T |
 |
| Q |
172 |
tgaaacaaaacaatggatagaatgatttttatttacaagcaaatgcaaggataaactgatgtggggctctctctg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11484183 |
tgaaacaaaacaatggatagaatgatttttatttacaagcaaatgcatggataaactgatgtggggctctctctg |
11484109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 11326332 - 11326286
Alignment:
| Q |
1 |
tctgcaagataggatggtttattgggaggtcaaacaatacaaaattg |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11326332 |
tctgcaagataggatggtttattgggaggtcaaacaatacaaaattg |
11326286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 11484353 - 11484307
Alignment:
| Q |
1 |
tctgcaagataggatggtttattgggaggtcaaacaatacaaaattg |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11484353 |
tctgcaagataggatggtttattgggaggtcaaacaatacaaaattg |
11484307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University