View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_65 (Length: 250)
Name: NF10070_low_65
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 38037366 - 38037146
Alignment:
| Q |
17 |
tcgtatcaaacaaatatacgtagatctaactctacaagtaagatcacctaaacctttttgagaattctaagtcgaagattgttggnnnnnnnggttaata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38037366 |
tcgtatcaaacaaatatacgtagatctaactctacaagtaagatcacctaaacctttttgagaattctaagtcgaagattgttggaaaaaaaggttaata |
38037267 |
T |
 |
| Q |
117 |
atcaatgaatgatgaaattggagaaatatggaggaagagttgagatttttatttggtttttgtttagatctatgcttgatagttgaatgtgaaattgtaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38037266 |
atcaatgaatgatgaaattggagaaatatggaggaagagctgagatttttatttggtttttgtttagatctatgcttgatagttgaatgtgaaattgtaa |
38037167 |
T |
 |
| Q |
217 |
tgaagatttaggttgttacct |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38037166 |
tgaagatttaggttgttacct |
38037146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University