View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_66 (Length: 250)
Name: NF10070_low_66
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_66 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 42 - 250
Target Start/End: Original strand, 30885518 - 30885726
Alignment:
| Q |
42 |
gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctataatcttgacaggctaaaaatgttatgtgaatca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885518 |
gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctataatcttgacaggctaaaaatgttatgtgaatca |
30885617 |
T |
|
| Q |
142 |
aaattgtgcgaagaaatcaatactgagaccgtagccacaacacttgccctggctgagcaacaccattgtccacagctcaagacgatctgtttgagattta |
241 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30885618 |
aaattgtgtgaagaaatcaatactgagaccgtagccacgacacttgccctggctgagcaacaccattgtccacagctcaagacgatctgtttgaaattta |
30885717 |
T |
|
| Q |
242 |
ttgcaaatc |
250 |
Q |
| |
|
||||||||| |
|
|
| T |
30885718 |
ttgcaaatc |
30885726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 43
Target Start/End: Original strand, 30885177 - 30885206
Alignment:
| Q |
14 |
agggtgagttgtctctatcaaaataaacgg |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30885177 |
agggtgagttgtctctatcaaaataaacgg |
30885206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University