View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_67 (Length: 247)
Name: NF10070_low_67
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 7165605 - 7165844
Alignment:
| Q |
1 |
gttgttagggtttgggatcagtatagagttgaaagtagaatagtgtgtactgaatcttataacattgttatggctctttatgtagaaatgggtaaggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7165605 |
gttgttagggtttgggatcagtatagagttgaaagtagaatagtgtgtactgaatcttataacattgttatgactctttatgtagaaatgggtaaggatt |
7165704 |
T |
 |
| Q |
101 |
ctgaggctgttggaattttttgtaagatggttgatgacgggtcggttccgaattgtagaagttatagtataataattgagcaccttgtgaaatgtaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165705 |
ctgaggctgttggaattttttgtaagatggttgatgacgggtcggttccgaattgtagaagttatagtataataattgagcaccttgtgaaatgtaggaa |
7165804 |
T |
 |
| Q |
201 |
gtttttggaagctattgaggtttttcatttgttgcctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7165805 |
gtttttggaagctattgaggtttttaatttgttgcctttg |
7165844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University