View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_70 (Length: 243)
Name: NF10070_low_70
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 24 - 225
Target Start/End: Complemental strand, 5726685 - 5726485
Alignment:
| Q |
24 |
aattcttaatacccaaattaatccttgnnnnnnnnnccaacatacaaaaacccttcggaaaaagaagatattaattggtatttctctctattcttatttg |
123 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726685 |
aattcttaatacccaaattaatccttgtttttttt-ccaacatacacaaacccttcggaaaaagaagatattaattggtatttctctctattcttatttg |
5726587 |
T |
 |
| Q |
124 |
tgaaaactatcatgaatatgatcacttctcaatattcttaattactttcgtgaaatattcaatttagatgtgaaatttaaatgacactacacgaggtcat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726586 |
tgaaaactatcatgaatatgatcacttctcaatattcttaattactttcgtgaaatattcaatttagatgtgaaatttaaatgacactacacgaggtcat |
5726487 |
T |
 |
| Q |
224 |
at |
225 |
Q |
| |
|
|| |
|
|
| T |
5726486 |
at |
5726485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University