View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10070_low_72 (Length: 241)

Name: NF10070_low_72
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10070_low_72
NF10070_low_72
[»] chr8 (1 HSPs)
chr8 (20-241)||(3748950-3749172)


Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 3749172 - 3748950
Alignment:
20 atgcgtggacgaatgaattttcaactagttaatctacgatgataaactaggatactcttcctgaaatgtgatatattggaagatcattattggannnnnn 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||          
3749172 atgcgtggacgaatgaattttcaactagttaatctacgatgataaactaggatactcttcctgaaatgtgatatattggaagatcattactggaattttt 3749073  T
120 nn--atatatccatgaaaatatgtggatatattgctttcaaatgtttctttgtatatccggttaacttttattgttacataataagttttacggagtatt 217  Q
        ||||||||||||||||||||||||| ||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||| ||    
3749072 ttttatatatccatgaaaatatgtggatacattgctt-caaatgtttttttgaatatccggttaacttttattgttacataataagttttacagagtgtt 3748974  T
218 taaaaatgtgatcaattgactacc 241  Q
    ||||||||||||||||||||||||    
3748973 taaaaatgtgatcaattgactacc 3748950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University