View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_72 (Length: 241)
Name: NF10070_low_72
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10070_low_72 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 3749172 - 3748950
Alignment:
Q |
20 |
atgcgtggacgaatgaattttcaactagttaatctacgatgataaactaggatactcttcctgaaatgtgatatattggaagatcattattggannnnnn |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
3749172 |
atgcgtggacgaatgaattttcaactagttaatctacgatgataaactaggatactcttcctgaaatgtgatatattggaagatcattactggaattttt |
3749073 |
T |
 |
Q |
120 |
nn--atatatccatgaaaatatgtggatatattgctttcaaatgtttctttgtatatccggttaacttttattgttacataataagttttacggagtatt |
217 |
Q |
|
|
||||||||||||||||||||||||| ||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
T |
3749072 |
ttttatatatccatgaaaatatgtggatacattgctt-caaatgtttttttgaatatccggttaacttttattgttacataataagttttacagagtgtt |
3748974 |
T |
 |
Q |
218 |
taaaaatgtgatcaattgactacc |
241 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
3748973 |
taaaaatgtgatcaattgactacc |
3748950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University