View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_75 (Length: 239)
Name: NF10070_low_75
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 30885711 - 30885943
Alignment:
| Q |
1 |
aaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaatgtttctgatgatactgcaggggtttgatttgatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885711 |
aaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaatgtttctgatgatactgcaggggtttgatttgatagt |
30885810 |
T |
 |
| Q |
101 |
ataatgcagccttcattt-------ttcattaataattaatatctatatttacattcaaaattaattatgacctgagatccttttgaatctcattcattc |
193 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885811 |
ataatgcaaccttcatttttcattattcattaataattaatatctatatttacattcaaaattaattatgacctgagatccttttgaatctcattcattc |
30885910 |
T |
 |
| Q |
194 |
cttctataagcgtgcttttagacttcatttttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30885911 |
cttctataagcgtgcttttagacttcatttttg |
30885943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University