View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_77 (Length: 237)
Name: NF10070_low_77
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 93 - 219
Target Start/End: Complemental strand, 39393640 - 39393515
Alignment:
| Q |
93 |
gtaatgaatgatttgaatagttaatgataggtaaatcatgaatttaggaagggttatataattagaatgttggaaaaagtaatgagacaggaatatagga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39393640 |
gtaatgaatgatttgaatagttaatgataggtaaatcatgaatttaggaagggttatataattagaatgttgg-aaaagtaatgagacaggaatatagga |
39393542 |
T |
 |
| Q |
193 |
gaaaaagagcaaaagaacgtgtgtact |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39393541 |
gaaaaagagcaaaagaacgtgtgtact |
39393515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University