View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_79 (Length: 229)
Name: NF10070_low_79
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10070_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 6 - 154
Target Start/End: Original strand, 36167192 - 36167340
Alignment:
Q |
6 |
aaaaggctacattatactttggattcatatattcattccttccctcttgactttgaatttgaaatccatgcactttcggtaaaatgcgtatgaaaaaggc |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36167192 |
aaaaggctacattatactttggattcatatattcattccttccctcttgactttgaatgtgaaatccatgcactttcggtaaaatgcgtatgaaaaaggc |
36167291 |
T |
 |
Q |
106 |
tacattatacatttggatacctgcacgtaaactaatgcctgcatcaata |
154 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36167292 |
tacattatacatttggatacctgcacgtaaactaatgcctgcatcaata |
36167340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 175 - 229
Target Start/End: Original strand, 36167366 - 36167420
Alignment:
Q |
175 |
atgatatggggcaatgactattctagagaggaatgatgatgtgtgccatctgcca |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36167366 |
atgatatggggcaatgactattctagagaggaatgatgatgtgtgccatctgcca |
36167420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University