View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_81 (Length: 220)
Name: NF10070_low_81
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_81 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 41990434 - 41990244
Alignment:
| Q |
16 |
tacacaacattagtagtaaaattcaagggagaatcacttaattaacttatgcatttgagctatcggtgcactt-gtttataattgaaagagtgagacaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41990434 |
tacacaacattagtagtaaaattcaagggagaatcacttaattaacttatgcatttgagctatcggtgcactttgtttataattgaaagagtgagacaaa |
41990335 |
T |
 |
| Q |
115 |
atgaaagtgtggggagtaaaaacattagagacagagctggtaacagtaacattaatgtctgaaatgctctatattcaaagtggtccaacgt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41990334 |
atgaaagtgtggggagtaaaaacattagagacagagctggtaacaataacattaatgtctgaaatgctctatattcaaagtggtccaacgt |
41990244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University