View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10070_low_84 (Length: 209)
Name: NF10070_low_84
Description: NF10070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10070_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 81 - 195
Target Start/End: Original strand, 6083244 - 6083358
Alignment:
| Q |
81 |
gttgtgatgattttgtggtcctgaattaattctttatcccaatttattctttttctaggatgatgataaccaatatgtaacaaatgattccatgaaagaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6083244 |
gttgtgatgattttgtggtcctgaattaattctttatcccaatttattctttttctaggatgatgataaccaatatgtaacaaatgattccatgaatgaa |
6083343 |
T |
|
| Q |
181 |
acccggaattgcctt |
195 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6083344 |
acccggaattgcctt |
6083358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 6083183 - 6083222
Alignment:
| Q |
20 |
agttgaaggacgaggcatttcgtggagagaattagacaat |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6083183 |
agttgaaggacgaggcatttcgtggagagaatcagacaat |
6083222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University