View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10071_high_12 (Length: 252)
Name: NF10071_high_12
Description: NF10071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10071_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 165 - 242
Target Start/End: Original strand, 37925954 - 37926031
Alignment:
| Q |
165 |
agtaaattgaaaatctattccttagaaaatgacacgttttgtgaattttgtaacataatggctgctgctgtttctctg |
242 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37925954 |
agtaaattgaaactctattccttagaaaatgacacgttttgtgaattttgtaacataatggctgctgctgtttctctg |
37926031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 29 - 95
Target Start/End: Original strand, 37925888 - 37925950
Alignment:
| Q |
29 |
tttttcttataaatacaactggagggagggagtgatttttaacgtatcaaaggatctatatgttata |
95 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37925888 |
ttttgcttataaatacaactggag----ggagtgatttttaacgtatcaaaggatctatatgttata |
37925950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University