View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10071_low_11 (Length: 292)
Name: NF10071_low_11
Description: NF10071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10071_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 98 - 282
Target Start/End: Complemental strand, 24861333 - 24861149
Alignment:
| Q |
98 |
tcagaataagaacccataagcaagttcatcatttcatgtcgaaaattcggctcaaatttcccattcagttgaactaaacttctcttccaacgaaaccttc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24861333 |
tcagaataagaacccataagcaagttcatcatttcatgtcgaaaattcggctcaaatttcccattcagttcaactaaacttctcttccaacgaaaccttc |
24861234 |
T |
|
| Q |
198 |
aattgcaacacacacaaatctaaacacaaatactcatttacaaaaatcacttaaataaataacttttaaactaattatacctatg |
282 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24861233 |
aattgcaacacacacaaatctaaacactaatactcaattacaaaaatcacttaaataaataacttttaaactaattttacctatg |
24861149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University