View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10071_low_4 (Length: 439)
Name: NF10071_low_4
Description: NF10071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10071_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 38051162 - 38051380
Alignment:
| Q |
18 |
attacatcatttgcaaacatatgcatacatgtctccaaaggtaggattaatatatttggtcaaagaaaacaactcctattgaattggacactccacctag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38051162 |
attacatcatttgcaaacatatgcatacatgtctccaaaggtaggattaatatatttggtcaaagaaaacaactccaattgaattggacactccacctag |
38051261 |
T |
 |
| Q |
118 |
ctcatgcaaatgtatgcatgtaaatttcccctccaagctcatgcatgactggacttgggattctttgcaacagattttatggtgcactcgactagcttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051262 |
ctcatgcaaatgtatgcatgtaaatttcccctccaagctcatgcatgactggacttgggattctttgcaacagattttatggtgcactcgactagcttat |
38051361 |
T |
 |
| Q |
218 |
gattcattttgtgcatgcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38051362 |
gattcattttgtgcatgcc |
38051380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 338 - 439
Target Start/End: Original strand, 38051494 - 38051594
Alignment:
| Q |
338 |
gagagagacacgtggtagcatttcctcatgcattccaccgtacatattgcaacacttaccagcttttggtaatgcataccttgtcctctctgctcctcct |
437 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||| |
|
|
| T |
38051494 |
gagagagacacgtggtagcatttcctcatgcattccaccgtacatattgcaacacttaccagc-tttggtaatgcataccttgtcctcattgatcctcct |
38051592 |
T |
 |
| Q |
438 |
ca |
439 |
Q |
| |
|
|| |
|
|
| T |
38051593 |
ca |
38051594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University