View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10071_low_7 (Length: 356)
Name: NF10071_low_7
Description: NF10071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10071_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 9733812 - 9733608
Alignment:
Q |
1 |
ttggcaagttggtaacgtggattcgttcaggttcttttgggagaaacaatcaaagacaacgacatcacctaaaggaaggaagtgaaaaacaactcttcaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
9733812 |
ttggcaagttggtaacgtggattcgttcaggttcttttgggagaaacaatcaaagacaaagacatcacctaaaggaaggaagagaaaaacaactcttcaa |
9733713 |
T |
 |
Q |
101 |
aaagttggttttggttttgcagcttcaacaagtgaaatcaaatgagttaaacaaaaaagtgatctttgatttt----cattgtcactcaccaacaaaccc |
196 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
9733712 |
aaagttggttttggttttgcagcttcaacaagtgaaatcaaatgagttaaacaaaaaagtgatctttgattttcattcattgtcactcaccaacaaaccc |
9733613 |
T |
 |
Q |
197 |
aagac |
201 |
Q |
|
|
||||| |
|
|
T |
9733612 |
aagac |
9733608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 274 - 335
Target Start/End: Complemental strand, 9733531 - 9733470
Alignment:
Q |
274 |
catgaagttagtactaccttatttttatgtgtgtaactgaaaaaccaaaaacatgcatttaa |
335 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9733531 |
catgaagttagtactaccttatttttatgtgtgtaactgaaaaaccaaaaacatgcatttaa |
9733470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University