View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10071_low_9 (Length: 348)
Name: NF10071_low_9
Description: NF10071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10071_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 19 - 320
Target Start/End: Original strand, 5158550 - 5158851
Alignment:
| Q |
19 |
gagaatcttcttgatgatgacgaccctttcttactactttaaattggaaaatagtatctttctagcaaatgatattgggcttgatactgacctaatgaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
5158550 |
gagaatcttcttgatgatgacgaccctttcttactactttaaattggaaaatagtatctttctagcaaacgatattgggcttgatactgacctaataaga |
5158649 |
T |
 |
| Q |
119 |
ttagattatgaaatctactttataatatcatgattcatgaactcagtattatttgttttaaatcattatgaaagtctggagatatttaagaatgaggagt |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5158650 |
tcagattatgaaatctactttataatatcatgattcatgaactcagtattatttgttttaaatcattatgaaagtctggagatatttaagaatgaggagt |
5158749 |
T |
 |
| Q |
219 |
caaatctcaaggactagtttaactgatttgaaaatatcatatgctttttctacgtatcattcttatacatgtcatcccctctctataattaacatctcac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5158750 |
caaatctcaaggactagtttaactgatttgaaaatatcatatgctttttctacgtatcattcttatacatgtcatcccctctctataattaacatctcac |
5158849 |
T |
 |
| Q |
319 |
ac |
320 |
Q |
| |
|
|| |
|
|
| T |
5158850 |
ac |
5158851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University