View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10073_high_8 (Length: 254)
Name: NF10073_high_8
Description: NF10073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10073_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 26 - 244
Target Start/End: Complemental strand, 761671 - 761458
Alignment:
| Q |
26 |
cagaaacattgtatgttgtctactacatgcttcatggcatgacctactcccatagcaaaagaaaaatctctgttttgttcctttgaggaaccgaccccaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
761671 |
cagaaacattgtatgttgtctactacatgcttcatggcat-acctactcccacagcaaaagaaaaatctctgttttgttcctttgaggaaccgaccccaa |
761573 |
T |
 |
| Q |
126 |
atatataaacaatcggtaattgagaccaaactaagaccagctccttcaccattcacaataagcatagaatgaataacataaataaaaatttaacatataa |
225 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
761572 |
ata----aacaatcggtaattgagaccaaactaagaccagctccttcaccattcacaataagcatagaatgaataacataaataaaaatttaacatataa |
761477 |
T |
 |
| Q |
226 |
gttgaacctaacacctatg |
244 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
761476 |
gttgaacctaacacctatg |
761458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University