View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10073_low_11 (Length: 246)
Name: NF10073_low_11
Description: NF10073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10073_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 236
Target Start/End: Original strand, 23522700 - 23522934
Alignment:
| Q |
3 |
acttatatatggcctatgctagcactctatcaccgtcttctcttcacaattaatcacctgaaaaacaaaatccaaaacaagatacattacaaattgacta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522700 |
acttatatatggcctatgctagcactctatcaccgtcttctcttcacaattaatcacctgaaaaacaaaatccaaaacaagatacattacaaattgacta |
23522799 |
T |
 |
| Q |
103 |
tgatcaattgatt-nnnnnnnntcaaaccataatctaggctagatgcattgatataatatataagagcatatttaggtgtacacatgaaattaacaatgt |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23522800 |
tgatcaattgattaaaaaacaatcaaaccataatctaggctagatgcattgatataatatataagagcatatttaggtgtacccatgaaattaacaatgt |
23522899 |
T |
 |
| Q |
202 |
ggatggcacatgggaaacgacatttatatcctttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522900 |
ggatggcacatgggaaacgacatttatatcctttg |
23522934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 66
Target Start/End: Original strand, 23517390 - 23517431
Alignment:
| Q |
25 |
cactctatcaccgtcttctcttcacaattaatcacctgaaaa |
66 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23517390 |
cactccatcaccgtcttctcttcataattaatcacctgaaaa |
23517431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University