View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10074_low_12 (Length: 291)
Name: NF10074_low_12
Description: NF10074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10074_low_12 |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0069 (1 HSPs) |
 |  |  |
|
| [»] scaffold2142 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 24072819 - 24072576
Alignment:
| Q |
18 |
catttatcctgttttagattaactcctttttctccgtgaatttttcattcaaccagaaattgcctcttcagtatctttctcaagtcttgttgaaattcgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24072819 |
catttatcctgttttagattaactcctttttctccgtgaatttctcattcaaccagaaattgcctcttcagtatctttctcaagtcttgttgaaattcgc |
24072720 |
T |
 |
| Q |
118 |
aagtggaaaaggcggaaacttgtgttttctttttctagaatctaagcg--cgcgtttctttttctgggatgtttgcccaataannnnnnnagttaatgtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| | | | |||||||||||||||| | ||| |||| |
|
|
| T |
24072719 |
aagtggaaaaggcggaaacttgtgttttctttttctggaatctaagcgcgcgcgtttcttctccggtgatgtttgcccaataatttttataattagtgtg |
24072620 |
T |
 |
| Q |
216 |
ttaatgggtttttgggttcgatctaatgtgc-aaaattatcgat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24072619 |
ttaatgggtttttgggttcgatctaatgtgcaaaaattatcgat |
24072576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 210 - 277
Target Start/End: Original strand, 31028454 - 31028522
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgctc |
277 |
Q |
| |
|
|||||||||||| | |||| |||| |||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
31028454 |
aatgtgttaatgagcttttaggttggatctaatgtgcaaaaattatcgatcgagtccgggcaaccgctc |
31028522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 34948848 - 34948914
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
34948848 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcctgggcgaccgc |
34948914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 398694 - 398628
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | |||| |||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
398694 |
aatgtgttaatgagctttttggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
398628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 134; Significance: 9e-70; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 22 - 267
Target Start/End: Original strand, 35951247 - 35951493
Alignment:
| Q |
22 |
tatcctgttttagattaactcctttttctccgtgaatttttcattcaaccagaaattgcctcttcagtatctttctcaagtcttgttgaaattcgcaagt |
121 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
35951247 |
tatcccgttttagattaactcatttttctccttgaatttttcattcaaccagaaattccctcttcagtatctttcttaagtctttttaaaattcgcaagt |
35951346 |
T |
 |
| Q |
122 |
ggaaaaggcggaaacttgtgttttctttttctagaatctaagcgcgcgtttctttttctgggatgtttgcccaataannnnnnnagttaatgtgttaatg |
221 |
Q |
| |
|
| |||| ||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||| |||||| | |||| |||||||||| |
|
|
| T |
35951347 |
gcaaaaagcggaaacttgtgttttctttttctggaatctaagcgtgcgtttcttttcctgggatgtttccccaatgatattttttgttagtgtgttaatg |
35951446 |
T |
 |
| Q |
222 |
ggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgg |
267 |
Q |
| |
|
|| | |||||||||| ||||||| | |||||||||||||||| |||| |
|
|
| T |
35951447 |
ggctattgggttcgacctaatgtacaaaaattatcgatcgagcccgg |
35951493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 7433522 - 7433456
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
7433522 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatagatcgagctcgggcgaccgc |
7433456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 26144332 - 26144266
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | |||| |||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
26144332 |
aatgtgttaatgagctttttggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
26144266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 271
Target Start/End: Original strand, 42311031 - 42311093
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcga |
271 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
42311031 |
aatgtgttaacgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcga |
42311093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 321469 - 321533
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||| |||||||||||| |||| ||||||| |
|
|
| T |
321469 |
tgtgttaatggacttttgggttggatctaatgcacaaaaattatcgatcgagcccggacgaccgc |
321533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 41972367 - 41972430
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || |||| |||| |||||||||||| |||||||||||||||| || ||||||||| |
|
|
| T |
41972367 |
tgtgttaataggcttttaggttggatctaatgtgcaaaaattatcgatcgag-ccaggcgaccgc |
41972430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 14)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 22 - 273
Target Start/End: Complemental strand, 202917 - 202652
Alignment:
| Q |
22 |
tatcctgttttagattaactcctttttctccgtgaatttttcattcaaccagaaattgcctcttcagtatctttctcaagtcttgttgaaattcgcaagt |
121 |
Q |
| |
|
||||||||||||||||||||| |||| |||| ||||||||| |||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
202917 |
tatcctgttttagattaactcattttcctccttgaattttttattcaaccaggaattggctcttcagtatctttctcaagtcttgttaaaattcgcaagt |
202818 |
T |
 |
| Q |
122 |
ggaaaaggcggaaac------------ttgtgttttctttttctagaatctaagcgcgcgtttctttttctgggatgtttgcccaataa-nnnnnnnagt |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||| || |
|
|
| T |
202817 |
ggaaaaggcggaaactgcgacaaaaatttgtgttttctttttctggaatctaagcgcgcgtttcttttccttggatgtttgcccaataatatttttttgt |
202718 |
T |
 |
| Q |
209 |
taatgtgttaatgggtttttgggttcgatctaatgtgca-aaattatcgatcgagtccgggcgacc |
273 |
Q |
| |
|
|| ||| |||||||| |||||||||||| ||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
202717 |
tagtgtcttaatgggcttttgggttcgacctaatgtacacaaattatcgatcgagcccgggcgacc |
202652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 12278952 - 12279016
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || |||||||| | |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12278952 |
tgtgttaattggcctttgggttgggtctaatgtgcaaaaattatcgatcgagtccgggcgaccgc |
12279016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 210 - 277
Target Start/End: Original strand, 36293711 - 36293779
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgctc |
277 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
36293711 |
aatgtgttaatgggcttttgggttgagtctaatgtacaaaaattatcgatcgagtccggacgaccgctc |
36293779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 271
Target Start/End: Complemental strand, 10034004 - 10033942
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcga |
271 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
10034004 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcga |
10033942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 13818054 - 13817988
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
13818054 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgagcgaccgc |
13817988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 273
Target Start/End: Complemental strand, 28801362 - 28801300
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgacc |
273 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
28801362 |
tgtgttaatgggcttttggtttggatctaatgtgcaaaaattatcgatcgagccagggcgacc |
28801300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 39434773 - 39434707
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
39434773 |
aatgtgttaatgggcttttgggttgagtctaatgtgaaaaaattatcgatcgagcccgggcgaccgc |
39434707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 210 - 268
Target Start/End: Complemental strand, 16155074 - 16155015
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccggg |
268 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
16155074 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccggg |
16155015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 269
Target Start/End: Original strand, 31501808 - 31501866
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggc |
269 |
Q |
| |
|
||||||||| || ||||||||| | |||||||||| |||||||||||||||| |||||| |
|
|
| T |
31501808 |
tgtgttaattggcttttgggttgggtctaatgtgcaaaaattatcgatcgagcccgggc |
31501866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 272
Target Start/End: Complemental strand, 33430396 - 33430335
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgac |
272 |
Q |
| |
|
||||||||| || ||||||||| | ||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
33430396 |
tgtgttaattggcttttgggttgggtctaatgcgcaaaaattatcgatcgagcccgggcgac |
33430335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 250
Target Start/End: Original strand, 16333966 - 16334006
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa |
250 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
16333966 |
aatgtgttaatgggcttttgggttgaatctaatgtgcaaaa |
16334006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 271
Target Start/End: Original strand, 17332643 - 17332703
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcga |
271 |
Q |
| |
|
||||||||| || ||||||||| | |||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
17332643 |
tgtgttaattggcttttgggttgggtctaatatgcaaaaattatcgatcgagcccgggcga |
17332703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 31680442 - 31680378
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| | ||||||| | |||| |||||||||||| |||||||||||| |
|
|
| T |
31680442 |
tgtgttaattggcttttgggttgggtctaatgcggaaaaattatcgatcgagcccgggcgaccgc |
31680378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 37254716 - 37254652
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| | ||||||||| | |||||||||||||| |||||||||||| | |||||||||| |
|
|
| T |
37254716 |
tgtgttaattgacttttgggttgggtctaatgtgcaaaaattatcgatcgagcctgggcgaccgc |
37254652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 36408628 - 36408562
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
36408628 |
aatgtgttaatggacttttgggttggatctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
36408562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 270
Target Start/End: Complemental strand, 3435344 - 3435285
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcg |
270 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||||||| || ||||||| |
|
|
| T |
3435344 |
tgtgttaatgggtttttgggttgggtctaatgtgcaaaaattatcgatcaagcccgggcg |
3435285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 16788117 - 16788181
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
16788117 |
tgtgttaattggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
16788181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 23402183 - 23402119
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaa-attatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| | |||||| |||||| ||||||||||||| |||||||||||| |
|
|
| T |
23402183 |
tgtgttaattggcttttgggttgggtctaatatgcaaagattatcgatcgagcccgggcgaccgc |
23402119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 210 - 272
Target Start/End: Original strand, 3648884 - 3648947
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgac |
272 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
3648884 |
aatgtgttaatgggcttttgggttgagtctaatgtgaaaaaattatcgatcgagcccgggcgac |
3648947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 214 - 275
Target Start/End: Complemental strand, 4404081 - 4404019
Alignment:
| Q |
214 |
tgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
4404081 |
tgttaattggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
4404019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 212 - 277
Target Start/End: Original strand, 34136917 - 34136983
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgctc |
277 |
Q |
| |
|
||||||||| | ||||||||| |||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
34136917 |
tgtgttaattgacttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgctc |
34136983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 39914592 - 39914526
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | |||| |||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
39914592 |
aatgtgttaatgagctttttggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
39914526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 210 - 274
Target Start/End: Original strand, 29728476 - 29728541
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccg |
274 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
29728476 |
aatgtgttaatgagcttttgggttgagtctaatgtgcaaaatttatcgatcgagcacgggcgaccg |
29728541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 2729288 - 2729352
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| |||||| || ||| ||||||| |||| |||||||||||| ||||||| |||| |
|
|
| T |
2729288 |
tgtgttaatgggcttttggattggatttaatgtgtaaaaattatcgatcgagcccgggcgtccgc |
2729352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 2958191 - 2958256
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
2958191 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaattatcgatcgagcccggacgaccgc |
2958256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 41251724 - 41251790
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
41251724 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
41251790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 42440063 - 42439997
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
42440063 |
aatgtgttaatgggcttttgggtttagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
42439997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 771074 - 771010
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| |||| |||| | |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
771074 |
tgtgttaatgggctttttggttgggtctaatgtgcaaaagttatcgatcgagcccgggcgaccgc |
771010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 45418658 - 45418594
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| ||||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
45418658 |
tgtgttaattggcttttgggttggatctaatgcgcaaaaattatcgatcgagcccgggcgaccgc |
45418594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 26238031 - 26237968
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||||| |||||| || ||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
26238031 |
tgtgttaatggacttttggtttgcatctaatttgcaaaaatatcgatcgagcccgggcgaccgc |
26237968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 8147426 - 8147362
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaa-attatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| | ||||| ||| | ||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8147426 |
tgtgttaattgacttttgagttgggtctaatgtgcaaagattatcgatcgagcccgggcgaccgc |
8147362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 17511324 - 17511390
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
17511324 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagtctgggcgaccgc |
17511390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 20129387 - 20129321
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
20129387 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
20129321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 50205169 - 50205233
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| |||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
50205169 |
tgtgttaattggcttttgggttggatctaatgtgcaaaaattatcgatcgagctcgggcgaccgc |
50205233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 13012265 - 13012199
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | |||| |||| ||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
13012265 |
aatgtgttaatgagctttttggttgaatctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
13012199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 26439369 - 26439435
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
26439369 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgaccgagcccgggcgaccgc |
26439435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 34407374 - 34407440
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
34407374 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgaccgagcccgggcgaccgc |
34407440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 3292988 - 3293052
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| | ||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
3292988 |
tgtgttaattggcttttgggttgggtctaatgggcaaaaattatcgatcgagcccgggcgaccgc |
3293052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 6690327 - 6690391
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| | ||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
6690327 |
tgtgttaattggcttttgggttgggtctaatgcgcaaaaattatcgatcgagcccgggcgaccgc |
6690391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 267
Target Start/End: Complemental strand, 26448128 - 26448072
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgg |
267 |
Q |
| |
|
||||||||||| ||||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
26448128 |
tgtgttaatggacttttgggttagatttaatgtgcaaaaattatcgatcgagtccgg |
26448072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 30216834 - 30216898
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| | ||||||||| | |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
30216834 |
tgtgttaattagcttttgggttgggtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
30216898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 43143676 - 43143740
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
43143676 |
tgtgttaattggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
43143740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 274
Target Start/End: Complemental strand, 30110031 - 30109968
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccg |
274 |
Q |
| |
|
||||||||||| ||| || || | |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30110031 |
tgtgttaatggtctttgggtttgggtctaatgtgcaaaaattatcgatcgagtccgggcgaccg |
30109968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 210 - 272
Target Start/End: Complemental strand, 43355981 - 43355918
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgac |
272 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||||||||||| |||| ||||||||| |
|
|
| T |
43355981 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgaccgagcccgggcgac |
43355918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 10352974 - 10353040
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
10352974 |
aatgtgttaatggactttttggttgggtctaatgtgcaaaaattatcgattgagcccgggcgaccgc |
10353040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 25930785 - 25930719
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
25930785 |
aatgtgttaatgggcttttgggttgagtttaatgtgcaaaaattatagatcgagcccgggcgaccgc |
25930719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 29319795 - 29319861
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| | || ||||||| |
|
|
| T |
29319795 |
aatgtgttaatgggattttgggttgagtctaatgtgcaaaaattatcgatcgagcctggacgaccgc |
29319861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 47500850 - 47500784
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | |||| |||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
47500850 |
aatgtgttaatgagctttttggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
47500784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 273
Target Start/End: Complemental strand, 40529092 - 40529028
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgacc |
273 |
Q |
| |
|
|||||||||||| |||||| |||| | |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40529092 |
aatgtgttaatgagtttttaggttgagtttaatgtgcaaaaattatcgatcgagtccggacgacc |
40529028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 6269516 - 6269582
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
6269516 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagtccggacgaccgc |
6269582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 210 - 274
Target Start/End: Original strand, 6930984 - 6931049
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccg |
274 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
6930984 |
aatgtgttaattggcttttgggttggatctaatgcgcaaaaattatcgatcgagcccgggcgaccg |
6931049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 22968534 - 22968600
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
22968534 |
aatgtgttaatgggcttttgggttaagtctaatgtgcaaaaattatcgatcgagcccggacgaccgc |
22968600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 34084212 - 34084278
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||||||| |||| |||| || |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34084212 |
aatgtgttaatggactttttggttgaatttaatgtgcaaaaattatcgatcgagtccgggcgaccgc |
34084278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 39771867 - 39771801
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
39771867 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgaccgagcccgggcgaccgc |
39771801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 45183056 - 45182992
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| | ||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
45183056 |
tgtgttaattggcttttgggttgggtctaatgcgcaaaaattatcgatcgagcccgggcgaccgc |
45182992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 19565591 - 19565657
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||||||| ||||| |||| | |||||||||| |||||||||||| || |||||||||||| |
|
|
| T |
19565591 |
aatgtgttaatggattttttggttgggtctaatgtgcaaaaattatcgattgaacccgggcgaccgc |
19565657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 272
Target Start/End: Complemental strand, 27935253 - 27935192
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgac |
272 |
Q |
| |
|
|||||||||| | ||||||||| | | |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
27935253 |
tgtgttaatgagcttttgggttgggtttaatgtgcaaaaattatcgatcgagcccgggcgac |
27935192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 11018304 - 11018368
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| |||||||||||||| |||||||||||| | |||||||||| |
|
|
| T |
11018304 |
tgtgttaattggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcctgggcgaccgc |
11018368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 210 - 274
Target Start/End: Original strand, 3114186 - 3114251
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccg |
274 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
3114186 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccg |
3114251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 5555564 - 5555498
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||| ||||||||| ||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
5555564 |
aatgcgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
5555498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 14777197 - 14777263
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
14777197 |
aatgtgttaatgagcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
14777263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 34389148 - 34389212
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| | ||||||||| | |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
34389148 |
tgtgttaattagcttttgggttgggtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
34389212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 35090243 - 35090179
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
||||||||| || ||||||||| | |||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
35090243 |
tgtgttaattggcttttgggttgggtctaatgtgcaaaaattattgatcgagcccgggcgaccgc |
35090179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 267
Target Start/End: Original strand, 40920093 - 40920151
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgg |
267 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
40920093 |
aatgtgttaattggcttttgggttaaatctaatgtgcaaaaattatcgatcgagcccgg |
40920151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 272
Target Start/End: Complemental strand, 33685639 - 33685578
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgac |
272 |
Q |
| |
|
|||||||||||| ||||||||| | | |||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
33685639 |
tgtgttaatgggcttttgggttgggtttaatgtgcaaaaattatcgatcgagcccgagcgac |
33685578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 274
Target Start/End: Complemental strand, 31555 - 31492
Alignment:
| Q |
212 |
tgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccg |
274 |
Q |
| |
|
|||||||||||| ||||||||| | |||| ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
31555 |
tgtgttaatgggcttttgggttgggtctagtgtgcaaaaattatcgatcgagcccgggcgaccg |
31492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0069 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0069
Description:
Target: scaffold0069; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 210 - 277
Target Start/End: Complemental strand, 17919 - 17851
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgggcgaccgctc |
277 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||||||||||| |||| ||| ||||| |
|
|
| T |
17919 |
aatgtgttaatgggcttttgggttgagtctaatgtgcaaaaattatcgatcgagcccggacgatcgctc |
17851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2142 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold2142
Description:
Target: scaffold2142; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Complemental strand, 599 - 533
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | |||| |||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
599 |
aatgtgttaatgagctttttggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 267
Target Start/End: Complemental strand, 53002 - 52944
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgc-aaaattatcgatcgagtccgg |
267 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
53002 |
aatgtgttaattggcttttgggttaaatctaatgtgcaaaaattatcgatcgagcccgg |
52944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 275
Target Start/End: Original strand, 480547 - 480613
Alignment:
| Q |
210 |
aatgtgttaatgggtttttgggttcgatctaatgtgcaaaa-ttatcgatcgagtccgggcgaccgc |
275 |
Q |
| |
|
|||||||||||| | |||| |||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
480547 |
aatgtgttaatgagctttttggttgagtctaatgtgcaaaaattatcgatcgagcccgggcgaccgc |
480613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University