View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10074_low_13 (Length: 267)
Name: NF10074_low_13
Description: NF10074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10074_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 32237202 - 32236964
Alignment:
| Q |
18 |
gcaccaataccatcatgcctcctcaacatatttttcatcacttggactttagtacttctccaaatcatgacaagtgtatctcttcacccaaaagtatgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32237202 |
gcaccaataccatcatgcctcctcaacatatttttcatcacttggactttagtacttctccaaatcatgacaagtgtatctcttcacccaaaagtatgtt |
32237103 |
T |
 |
| Q |
118 |
tcattttagattca-tttatttgttcaactcaccttttatctcatcatatgattttcatgtgaacttttttcttttctttcaataggtaaatggtggcat |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
32237102 |
tcattttagattcattttatttgttcaactcaccttttatctcatcatatgattttcatgtgaactttt---ttttctctcaataggtaaatggtggcat |
32237006 |
T |
 |
| Q |
217 |
tttaagtccaggattgatggggctatatgttgtcttcctttg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32237005 |
tttaagtccaggattgatggggctatatgttgtcttcctttg |
32236964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 43667351 - 43667435
Alignment:
| Q |
33 |
tgcctcctcaacatatttttcatcacttggactttagtacttctccaaatcatgacaagtgtatctcttcacccaaaagtatgtt |
117 |
Q |
| |
|
||||| |||||||| || |||||||||||||| |||||||| ||||| ||||||| || || ||||| ||||| |||||||||| |
|
|
| T |
43667351 |
tgccttctcaacattttcttcatcacttggacgctagtacttgtccaactcatgaccagcgtgtctctgcacccgaaagtatgtt |
43667435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University