View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10074_low_19 (Length: 249)
Name: NF10074_low_19
Description: NF10074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10074_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43110229 - 43109992
Alignment:
| Q |
1 |
atgtgcaaggtgtgtatatctatctaatctaatgtgaggagagaaattaattgaatacataatttcccaataaagataattttgaaattaattgtatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43110229 |
atgtgcaaggtgtgtatatctatctaatctaatgtgaggagagaaattaattgaatacataatttccctataaagataattttgaaattaattgtatttt |
43110130 |
T |
 |
| Q |
101 |
tcccatttgatgaatgaaacgatataactttattgtgnnnnnnntgttcaaatacttttcaattttattttgaattcaattttaacnnnnnnnngggaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||| || |
|
|
| T |
43110129 |
tcccatttgatgaatgaaacgatataactttattgtgaaaaaaatgttcaaatacttttcaattttattttgatttcaattttaacaaaaaaagggg-aa |
43110031 |
T |
 |
| Q |
201 |
gttgtctagtgcatcacgttttattatgtgttgtccttt |
239 |
Q |
| |
|
|||||||||||||| | ||||||| ||||||||||||| |
|
|
| T |
43110030 |
gttgtctagtgcatagctttttattctgtgttgtccttt |
43109992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University