View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10076_low_3 (Length: 301)
Name: NF10076_low_3
Description: NF10076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10076_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 300
Target Start/End: Original strand, 28207909 - 28208192
Alignment:
| Q |
17 |
atctggaacatagaactcagcagcagagcgatcaggagttccaatctcccataatgttggaccatctcttggaggctcaaagactatgtcatcaacattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28207909 |
atctggaacatagaactcagcagcagagcgatcaggaattccaatctcccataatgttggaccatctcttggaggctcaaagactatgtcatcaacattt |
28208008 |
T |
 |
| Q |
117 |
atctcgcaacctgcatgtttcaacaaacatggactttttatttgtgcgacttaaatcaactaacatggactgaagtataagccatttgactttgtttaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28208009 |
atctcgcaacctgcatgtttcaacaaacatggactttttatttgtgccacttaaatcaactaacatggactgaagtataagccatttgactttgtttaca |
28208108 |
T |
 |
| Q |
217 |
aattatagatttaaagtcttacatacttttgaaattttaattgtatgttaagatcgtataaaagggcacccccatatacacagg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
28208109 |
aattatagatttaaagtcttacatacttttgaaattttaatagtatgttaagatcgtataaaagggcaaccccatatacgcagg |
28208192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 52062680 - 52062754
Alignment:
| Q |
21 |
ggaacatagaactcagcagcagagcgatcaggagttccaatctcccataatgttggaccatctcttggaggctca |
95 |
Q |
| |
|
|||||||||||||||||||| |||||||| || | || || ||||| |||||||| ||||||||||| |||||| |
|
|
| T |
52062680 |
ggaacatagaactcagcagctgagcgatcggggatgcctatttcccacaatgttgggccatctcttggtggctca |
52062754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University