View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10076_low_6 (Length: 247)
Name: NF10076_low_6
Description: NF10076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10076_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 234
Target Start/End: Original strand, 15057675 - 15057885
Alignment:
Q |
12 |
agagatagcaggccttccatgagagcaaagcagtgagaaaactcggctttgataaggctattcatcaggctattcatctcgtccttggagaggtgagata |
111 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
T |
15057675 |
agagatagcaggccttccatgagagcaaagcagtgagaaaactcggcttcgataaggc------------tattcatctcgtccttggagaggtgagata |
15057762 |
T |
 |
Q |
112 |
actcatcctccatgagacgagatagctcgtcttcggtgagacgagatatctcggctttggagaggcgagtgaccttgcatgcgatgttgtcgaaggcatc |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
15057763 |
actcatcctccatgagacgagatagctcgtcttcggtgagacgagatatatcggctttggagaggcgagtgaccttgcatgcgatgttgtcgcaggcatc |
15057862 |
T |
 |
Q |
212 |
gcgaagagccgggtgaagttcgt |
234 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
15057863 |
gcgaagagccgggtgaagttcgt |
15057885 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University