View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10076_low_9 (Length: 243)
Name: NF10076_low_9
Description: NF10076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10076_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 41098187 - 41097976
Alignment:
| Q |
14 |
aaggagaaaatctcagaaagactttcaaatgtagagaatctatggtttccacgcgcacaacaatccaccgcaacactcccttctcaacgcaaatccatct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41098187 |
aaggagaaaatctcagaaagactttcaaatgtagagaatctatggtttccacgcgcacaacaatccaccgccacactcccttctcaacgcaaatccatct |
41098088 |
T |
 |
| Q |
114 |
tccactctcttctcacccgcgacccatccctcttcctagaacgctacggttccaatctcacttccaccgaattaaccgaattcgaaaccctaaaagaaga |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41098087 |
tccactctcttctcactcgcgacccatctctcttcctagaacgctacggttccaatctcacttccaccgaattaaccgaattcgaaaccctaaaagaaga |
41097988 |
T |
 |
| Q |
214 |
ttacgagattaa |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41097987 |
ttacgagattaa |
41097976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University