View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10077_high_20 (Length: 213)

Name: NF10077_high_20
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10077_high_20
NF10077_high_20
[»] chr4 (1 HSPs)
chr4 (1-194)||(51674076-51674269)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 51674076 - 51674269
Alignment:
1 aaccggaagcaaaaccgagagacggagcaatgaaatcgattgaattaacggaagagcattgagagattagcgtatcgaagagattttgaaacggtgacgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||    
51674076 aaccggaagcaaaaccgagagacggagcaatgaaatcgattgaattaacggaagagcattgagagattagcgtgttgaagagattttcaaacggtgacgg 51674175  T
101 tggaggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcgggaagaaaagag 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51674176 tggaggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcgggaagaaaagag 51674269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University