View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_high_21 (Length: 209)
Name: NF10077_high_21
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10077_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 48250033 - 48249888
Alignment:
Q |
18 |
gggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcctttgcctctgaatcagagatctgatagtgaggctttctc |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48250033 |
gggggtttgatggattgaagaaatggaagagaaatgaattggatgatgatgagactgctcctttgcctctgaatcagagatctgatagtgaggctttctc |
48249934 |
T |
 |
Q |
118 |
agcttcatctcagtcttttgcaagagcagttggcgatggaccggat |
163 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
48249933 |
agcttcatctcagtcttttgcaagagcagttggcgatgggccggat |
48249888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University