View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_high_8 (Length: 338)
Name: NF10077_high_8
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 30415400 - 30415095
Alignment:
| Q |
19 |
ctcatgctcaagggaattcttttactaactctccattctcttcatcatccagacatatggcatactatcgatagtctctatcaacaccaattgcagatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30415400 |
ctcatgctcaagggaattcttttactaactctccattctcttcatcatccagacatatggcatactatcgatagtctctatcaacaccaattgcagatga |
30415301 |
T |
|
| Q |
119 |
aagtaatttgagagacgaaaatatgtactgtaagaattaattctcattccatatatgattgattatacaacaccaaataaaaatttagctaggttttgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30415300 |
aagtaatttgagagacgaaaatatgtactgtaagaattaattctcattccatatatgattgattatacaacaccaaataaaaatttagataggttttgaa |
30415201 |
T |
|
| Q |
219 |
tctgttttcatcatgattaaatctgtaatcttcccttatttatagctatgtcatccccttcaagctccaatttaacagcttttagtagttctctttttgg |
318 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
30415200 |
tctgttttcatcatgattaaatatgtaatcttcccttatttatagctatgtcatccccttcaagctccaatttaaccgcttttagtagttctc-ttttgg |
30415102 |
T |
|
| Q |
319 |
tatctct |
325 |
Q |
| |
|
||||||| |
|
|
| T |
30415101 |
tatctct |
30415095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University