View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_12 (Length: 329)
Name: NF10077_low_12
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_low_12 |
 |  |
|
| [»] scaffold0548 (1 HSPs) |
 |  |  |
|
| [»] scaffold1743 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 6357075 - 6356765
Alignment:
| Q |
1 |
ataaagatcgtagagagacaaacaccaagattgtttaccactctctgattcacaatcaacgagtctttacaaagatacaaaagagtttaaaaaattaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6357075 |
ataaagatcgtagagagacaaacaccaagattgtttaccactctctgattcacaatcaacgagtctttacaaagatacaaaagagtttaaaaaattaatg |
6356976 |
T |
 |
| Q |
101 |
ttcgacatgaacaaaccctaattcctacctttttctcttattaaaatatataaacaatatgactcatatacctcatgtcttaaaggttttgggtggagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6356975 |
ttcgacatgaacaaaccctaattcctacctttttctcttattaaaatatataaacaatatgactcatatacctcatgtcttaaaggttttgggtggagat |
6356876 |
T |
 |
| Q |
201 |
gtggtgtcaccatctcgtggtcatggaatatttggacccgttgtttctcccgcaccccccaaaattcccaacagattctattgcaatgtgatatggattg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
6356875 |
gtggtgtcaccatctcgtggtcatggaatatttggacccgttgtttctcccgcaccccccaaaatccccaacagattatattgcaatgtgatacggattg |
6356776 |
T |
 |
| Q |
301 |
aacataagtcc |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
6356775 |
aacataagtcc |
6356765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 50391983 - 50391935
Alignment:
| Q |
160 |
tgactcatatacctcatgtcttaaaggttttgggtggagatgtggtgtca |
209 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
50391983 |
tgactcatatacctaatgtctt-aaggttttggatggagatgtcgtgtca |
50391935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22681222 - 22681171
Alignment:
| Q |
157 |
atatgactcatatacctcatgtcttaaaggttttgggtggagatgtggtgtca |
209 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
22681222 |
atatgactcatatacctaatgtcttaa-ggtttagggtggagatgtggtgtca |
22681171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 11307666 - 11307624
Alignment:
| Q |
165 |
catatacctcatgtcttaaaggttttgggtggagatgtggtgtc |
208 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
11307666 |
catatacctcatgtcttaatg-ttttgggtggagatgtggtgtc |
11307624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 19263361 - 19263310
Alignment:
| Q |
157 |
atatgactcatatacctcatgtcttaaaggttttgggtggagatgtggtgtca |
209 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| || |||||||||||||||| |
|
|
| T |
19263361 |
atatgactcatatacctaatgtctt-aaggtttaggatggagatgtggtgtca |
19263310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 50432 - 50483
Alignment:
| Q |
157 |
atatgactcatatacctcatgtcttaaaggttttgggtggagatgtggtgtca |
209 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| || |||||||||||||||| |
|
|
| T |
50432 |
atatgactcatatacctaatgtctt-aaggtttgggatggagatgtggtgtca |
50483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 51677364 - 51677411
Alignment:
| Q |
159 |
atgactcatatacctcatgtcttaaaggttttgggtggagatgtggtgt |
207 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
51677364 |
atgactcatatacctaatgtcttggag-ttttgggtggagatgtggtgt |
51677411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0548 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0548
Description:
Target: scaffold0548; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 4155 - 4113
Alignment:
| Q |
165 |
catatacctcatgtcttaaaggttttgggtggagatgtggtgtc |
208 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
4155 |
catatacctcatgtcttaatg-ttttgggtggagatgtggtgtc |
4113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1743 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1743
Description:
Target: scaffold1743; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 245 - 194
Alignment:
| Q |
157 |
atatgactcatatacctcatgtcttaaaggttttgggtggagatgtggtgtca |
209 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||| || |||||||||||||||| |
|
|
| T |
245 |
atatgactcatatatctaatgtcttaa-ggtttaggatggagatgtggtgtca |
194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 28296119 - 28296072
Alignment:
| Q |
160 |
tgactcatatacctcatgtcttaaaggttttgggtggagatgtggtgtc |
208 |
Q |
| |
|
|||| ||||||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
28296119 |
tgacccatatacctaatctcttaa-ggttttgggtggagatgtggtgtc |
28296072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University