View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_14 (Length: 309)
Name: NF10077_low_14
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 12 - 293
Target Start/End: Original strand, 30074824 - 30075105
Alignment:
| Q |
12 |
acagatgaatcaggaaaataccgtggtgaagttttaggagctgaggagacttttatgattcagaggagattatgcaacctgacatactgctttgtcttac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30074824 |
acagatgaatcaggaaaataccgtggtgaagttttaggagctgaggagacttttatgattcagaggagattatgcaacctgacatactgctttgtcttac |
30074923 |
T |
 |
| Q |
112 |
agttcatgctgttaatcttggtcctttggcttattgtgtctaatttagagcccaattccagggagtttgtgcccacgtaaatctgcaaagttgtgctccc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30074924 |
agttcatgctgttaatcttggtcctttggcttattttgtctaatttagagcccaattccagggagtttgtgcccacgtaaatctgcaaagttgtgctccc |
30075023 |
T |
 |
| Q |
212 |
tttgtgcattctcagaagtttattcactcatacttgatgtaaagtttcactgtcattgcacaaagacatttctttttgtgtg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30075024 |
tttgtgcattctcagaagtttattcactcatgcttgatgtaaagtttcactgtcatcgcacaaagacatttctttttgtgtg |
30075105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University