View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_17 (Length: 265)
Name: NF10077_low_17
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 7 - 249
Target Start/End: Original strand, 2260324 - 2260573
Alignment:
| Q |
7 |
ctgggtgggtgcctatactccctctttattcgtgctttctttattggtacgaattcgtgcaattttagtgtatgtttgatattaaggtggatacgcaaga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260324 |
ctgggtgggtgcctatactccctctttattcgtgcattctttattggtacgaattcatgcaattttagtgtatgtttgatattaaggtggatacgcaaga |
2260423 |
T |
|
| Q |
107 |
atcaccgtgattttgtagaaggtacaaattgtagtttcagaaaactcacagtgggt-------attttgacatatctatggtgatatcaaacattatata |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| | |||||||||||||||||||||||||||||| ||| || |
|
|
| T |
2260424 |
atcaccgtaattttgtagaaggtacaaattgtagtttctgaaaaatcacagtggatcgttgtaattttgacatatctatggtgatatcaaacactatcta |
2260523 |
T |
|
| Q |
200 |
atgtagcacaaaatactagggttttttaattaactaactgttacatttct |
249 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2260524 |
atgtagcacaaaatactaggtttttttaattaactaactgttacatttct |
2260573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 36322770 - 36322713
Alignment:
| Q |
105 |
gaatcaccgtgattttgtagaaggtacaaattgtagtttcagaaaactcacagtgggt |
162 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| ||||| |||| |||||| |
|
|
| T |
36322770 |
gaatcaccgtgattttgtagaagctacaaagtgtagtttttgaaaaatcacggtgggt |
36322713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University